dlamaturzysty.info

Biologia, matura 2015 - poziom rozszerzony - pytania i odpowiedzi

DATA: 7 maja 2015 r.
GODZINA ROZPOCZĘCIA: 14:00
CZAS PRACY: 180 minut
LICZBA PUNKTÓW DO UZYSKANIA: 60
Formuła od 2015 "nowa matura".

dostępne także:
w formie testu

• w aplikacji Matura - testy i zadania


Lista zadań

Odpowiedzi do tej matury możesz sprawdzić również rozwiązując test w dostępnej już aplikacji Matura - testy i zadania, w której jest także, np. odmierzanie czasu, dodawanie do powtórek, zapamiętywanie postępu i wyników czy notatnik :)

aplikacja_nazwa_h110.png google_play_h56.png app_store_h56.png

Dziękujemy developerom z firmy Geeknauts, którzy stworzyli tę aplikację

Zadanie 1. (0–3)
W tabeli cyfrą 1 zaznaczono obecność, a cyfrą 0 − brak niektórych cech u przedstawicieli wybranych gatunków strunowców. Poniżej tabeli zamieszczono drzewo filogenetyczne, na którym literami A–F oznaczono pewne grupy systematyczne strunowców oraz zaznaczono na gałęziach (liniach filogenetycznych) cechy, które w rozwoju ewolucyjnym u przodków tych grup pojawiły się po raz pierwszy.


Na podstawie: Biologia, red. N.A. Campbell, Poznań 2012.
pwz: 30%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 1.1.
Wybierz z tabeli i podaj nazwy wszystkich przedstawicieli strunowców należących do grup oznaczonych na drzewie filogenetycznym literami C i E.

Grupa C: .........................
Grupa E: .........................
pwz: 64%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 1.2.
Podaj wszystkie widoczne na drzewie filogenetycznym grupy kręgowców, których wspólny przodek miał cztery kończyny kroczne. Wymień oznaczenia literowe tych grup.
.........................
pwz: 49%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 1.3.
Zaznacz właściwe dokończenie zdania.

Przedstawione drzewo filogenetyczne
pwz: 30%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 2. (0–2)
Podczas doświadczenia wprowadzono do komórek wydzielniczych trzustki radioaktywne aminokwasy, a następnie śledzono zmiany promieniotwórczości. W określonych odstępach czasu dokonywano pomiaru stopnia radioaktywności w wybranych organellach komórkowych. Początkowo wykryto sygnał radioaktywny płynący z szorstkiej siateczki śródplazmatycznej, który stopniowo się osłabiał wraz ze wzrostem promieniotwórczości aparatu Golgiego (diktiosomów). Po osiągnięciu pewnego poziomu sygnał radioaktywny aparatu Golgiego zaczął maleć, a pojawił się w pęcherzykach przemieszczających się w kierunku błony komórkowej.
Na podstawie: L. Kłyszejko-Stefanowicz, Cytobiochemia, Warszawa 2002.

Przedstaw przyczyny zmian (wzrostu i spadku) radioaktywności szorstkiej siateczki śródplazmatycznej oraz aparatu Golgiego (diktiosomów). W odpowiedzi uwzględnij funkcję tych struktur.

Szorstka siateczka śródplazmatyczna:
.........................
.........................
Aparat Golgiego:
.........................
.........................
pwz: 59%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 3. (0–1)
Podczas wysiłku fizycznego w organizmie człowieka zachodzą takie procesy fizjologiczne, jak: zwiększone zaopatrywanie pracujących mięśni w glukozę, kwasy tłuszczowe i tlen, eliminowanie nadmiaru ciepła z organizmu, usuwanie z mięśni produktów przemiany materii, np. kwasu mlekowego i CO2. Procesy te możliwe są dzięki zmianom w pracy komórek, narządów i układów. Przykłady takich zmian (I–III) przedstawiono poniżej.

I. rozszerzenie naczyń krwionośnych w skórze
II. większa częstotliwość i pogłębienie oddechów
III. nasilone wychwytywanie glukozy i wolnych kwasów tłuszczowych z krwi przez włókna mięśniowe
Oceń, czy w trafnie przyporządkowano zmiany w pracy komórek, narządów i układów (I–III) do procesów fizjologicznych człowieka wykonującego pracę fizyczną w pomieszczeniu o temperaturze pokojowej. Wybierz tak, jeśli przyporządkowanie jest prawidłowe, albo nie – jeśli jest nieprawidłowe.
Eliminowanie nadmiaru ciepła z organizmu jest ułatwione dzięki I i II.
Usuwanie produktów przemiany materii, np. kwasu mlekowego i CO2, z włókien mięśniowych do krwi jest możliwe dzięki I i III.
Zaopatrzenie pracujących włókien mięśniowych w odpowiednią ilość substratów oddychania tlenowego jest możliwe dzięki II i III.
Zadanie 4. (0–6)
Mitochondria i chloroplasty pochodzą najpewniej od bakterii żyjących samodzielnie, które zostały pobrane do wnętrza komórki przodka organizmów eukariotycznych, ale nie zostały strawione. W obydwu organellach dochodzi do syntezy ATP. Zgodnie z modelem chemiosmozy, dzięki transportowi elektronów przez przenośniki związane z błoną, protony (H+) są przepompowywane na jej drugą stronę: w mitochondriach z matriks do przestrzeni międzybłonowej, a w chloroplastach – ze stromy do wnętrza (światła) tylakoidu. W błonę wbudowany jest enzym – syntaza ATP, który wykorzystuje do swojego działania powstałą różnicę stężeń H+. Źródła elektronów, przechodzących przez przenośniki łańcucha transportu elektronów, są różne w mitochondriach i w chloroplastach, ale istota procesu chemiosmozy jest taka sama w obydwu organellach – co przedstawiono na poniższym schemacie.



Na podstawie: Biologia, red. N.A. Campbell, Poznań 2012.
pwz: 41%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 4.1.
Podaj jeden argument na rzecz endosymbiotycznego pochodzenia mitochondriów i chloroplastów.
.........................
.........................
pwz: 33%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 4.2.
Na podstawie podanych informacji oceń prawdziwość stwierdzenia: „Synteza ATP w mitochondriach i chloroplastach zachodzi bezpośrednio w procesie przepompowywania protonów (H+) podczas transportu elektronów przez przenośniki łańcucha transportu elektronów”. Odpowiedź uzasadnij.
.........................
.........................
pwz: 32%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 4.3.
Określ, czy transport protonów (H+) z matriks mitochondrium i stromy chloroplastu jest aktywny, czy – bierny. Odpowiedź uzasadnij, korzystając z przedstawionych informacji.
.........................
.........................
pwz: 45%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 4.4.
Wyjaśnij, dlaczego zbyt wysoka temperatura może doprowadzić do zatrzymania syntezy ATP w mitochondriach i chloroplastach.
.........................
.........................
pwz: 41%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 4.5.
Podaj, w której fazie fotosyntezy (zależnej od światła czy niezależnej od światła) powstaje i do czego jest następnie wykorzystywany ATP wytwarzany w chloroplastach komórki roślinnej.
.........................
.........................
pwz: 29%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 4.6.
Podaj jeden przykład powiązania procesów metabolicznych zachodzących w chloroplastach z metabolizmem mitochondriów tej samej komórki roślinnej.
.........................
.........................
Zadanie 5. (0–3)
Na uproszczonym schemacie przedstawiono obieg azotu w przyrodzie, czyli cykl przemian wolnego azotu cząsteczkowego oraz jego związków nieorganicznych (np. amoniaku, azotanów(III) i (V)) i związków organicznych (np. białek). Istotną rolę w obiegu azotu odgrywają bakterie.
Na podstawie: T. Umiński, Ekologia, środowisko, przyroda, Warszawa 1995.
pwz: 42%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 5.1.
Na podstawie schematu oceń, czy poniższe informacje dotyczące udziału organizmów w krążeniu azotu są prawdziwe.
Bakterie wykorzystują obecne w środowisku nieorganiczne i organiczne związki azotowe.
Rośliny pobierają azot bezpośrednio ze środowiska w postaci azotanów(V), soli amonowych i azotu atmosferycznego.
Zwierzęta uczestniczą w przemianie nieorganicznych związków zawierających azot w azotowe związki organiczne, np. w białka.
pwz: 51%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 5.2.
Wybierz ze schematu jedną grupę bakterii i przedstaw jej rolę w przyswajaniu azotu przez rośliny.
.........................
.........................
pwz: 35%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 5.3.
Która grupa bakterii uwzględniona na schemacie wykorzystuje przemiany związków azotowych jako źródło energii koniecznej do syntezy własnych związków organicznych? Podaj nazwę tej grupy i nazwę tego procesu.

Grupa bakterii: .........................
Nazwa procesu: .........................
Zadanie 6. (0–3)
Rak wątroby jest chorobą, która może mieć wiele przyczyn. Jedną z nich jest wirusowe zapalenie wątroby typu B, wywołane przez wirus HBV. Wirus ten przenosi się podczas kontaktu z zakażoną krwią lub płynami ustrojowymi i namnaża się w komórkach wątroby. Według Światowej Organizacji Zdrowia (WHO) znacząca część ludzkości jest zainfekowana wirusem, ale u wielu ludzi zakażenie jest bezobjawowe i dochodzi do pełnego wyleczenia połączonego z nabyciem odporności. Ze względu na zmienność sekwencji DNA wirusa wyróżnia się kilka jego typów. WHO zaleca szczepienia przeciw HBV. W diagnostyce zakażeń wirusem HBV stosuje się kilka metod:
I. metodę serologiczną, w której wykrywa się we krwi antygeny powierzchniowe wirusa;
II. metodę serologiczną, w której wykrywa się we krwi przeciwciała przeciwko antygenom wirusa;
III. metodę, w której wykorzystuje się jedną z technik inżynierii genetycznej – technikę PCR.
pwz: 65%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 6.1.
Oceń, czy sformułowane przez uczniów hasła propagujące szczepienia przeciw HBV zawierają informacje prawdziwe.
Należy zaszczepić się przeciw HBV, aby zmniejszyć ryzyko zachorowania na wirusowe zapalenie wątroby typu B.
Należy zaszczepić się przeciw HBV w celu zabezpieczenia się przed wniknięciem wirusa HBV do organizmu.
Należy zaszczepić się przeciw HBV, ponieważ dzięki temu uniknie się zachorowania na raka wątroby.
pwz: 66%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 6.2.
Określ, za pomocą której metody diagnostycznej (I–III) można stwierdzić, że osoba zdrowa, która nie była szczepiona przeciw HBV, w przeszłości przeszła wirusowe zapalenie wątroby typu B. Odpowiedź uzasadnij.
.........................
.........................
pwz: 31%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 6.3.
Podaj, którą metodę (I–III) należy zastosować, aby można było z największą dokładnością określić typ wirusa HBV, który w badanej próbce krwi znajduje się w bardzo małej ilości. Odpowiedź uzasadnij.
.........................
.........................
Zadanie 7. (0–4)
Skrętnicę, która jest nitkowatym glonem zawierającym spiralnie skręcony chloroplast, umieszczono w roztworze zawierającym zdolne do aktywnego ruchu bakterie tlenowe. Wykonano trzy powtórzenia doświadczenia (A–C), które różniły się sposobem oświetlenia wybranej komórki skrętnicy:
  • zestaw A – komórka skrętnicy była oświetlona światłem białym punktowo w dwóch miejscach (1 i 2)
  • zestaw B – komórka skrętnicy była oświetlona równomiernie światłem białym
  • zestaw C – komórka skrętnicy była oświetlona punktowo światłem czerwonym w miejscu (3) i zielonym – w miejscu (4).
Każdy z zestawów był zabezpieczony przed dostaniem się powietrza atmosferycznego z zewnątrz. Po pewnym czasie można było zaobserwować charakterystyczne rozmieszczenie bakterii wokół komórek skrętnicy. Warunki i wyniki doświadczenia zilustrowano na poniższych rysunkach.

Zestaw A. ciemność


Zestaw B. światło białe


Zestaw C. ciemność


Na podstawie: D.O. Hall, K.K. Rao, Fotosynteza, Warszawa 1999.
pwz: 41%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 7.1.
Wyjaśnij, czym jest spowodowany sposób rozmieszczenia bakterii przedstawiony na rysunku B. W odpowiedzi uwzględnij odpowiedni proces zachodzący w komórce skrętnicy.
.........................
.........................
pwz: 79%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 7.2.
Spośród podanych propozycji podaj dwa właściwe sformułowania problemu badawczego i dwa odpowiednio sformułowane wnioski dotyczące przedstawionych doświadczeń. Wymień numery tych propozycji w wyznaczone miejsca.

1. Wpływ barwy światła na zachodzenie procesu fotosyntezy w komórkach skrętnicy.
2. W procesie fotosyntezy komórki skrętnicy wykorzystują światło o czerwonej barwie.
3. W którym obszarze komórki skrętnicy zachodzi proces fotosyntezy?
4. Badania nad wykorzystaniem światła w procesie fotosyntezy.
5. W cytozolu skrętnicy nie zachodzi faza fotosyntezy zależna od światła.

Problemy badawcze: .........................
Wnioski: .........................
pwz: 43%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 7.3.
Oceń, czy na podstawie przedstawionych doświadczeń można stwierdzić, że bakterie wykazują fototaksję dodatnią – przemieszczają się w kierunku światła. Odpowiedź uzasadnij, uwzględniając odpowiedni zestaw doświadczalny.
.........................
.........................
Zadanie 8. (0–2)
Na rysunku przedstawiono jemiołę Viscum album. Jemioła jest półpasożytem o skórzastych, zimozielonych liściach, występującym głównie na drzewach liściastych. Wytwarza białe, lepkie jagody, zjadane przez ptaki i przenoszone z drzewa na drzewo. Nasiona przyklejają się do gałęzi. Z nasion kiełkują siewki. Wytwarzają one charakterystyczne organy – ssawki wrastające poprzez korę żywiciela aż do tkanki, z której czerpią wodę i sole mineralne.
Na podstawie: http://biodidac.bio.uottawa.ca
pwz: 38%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 8.1.
Uzasadnij, że jemioła jest półpasożytem. W odpowiedzi uwzględnij dwie przedstawione w zadaniu cechy jej budowy.
.........................
.........................
pwz: 34%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 8.2.
Podaj nazwę tkanki przewodzącej żywiciela oraz nazwę komórek tej tkanki, z których jemioła czerpie niezbędne substancje.

Nazwa tkanki przewodzącej: .........................
Nazwa komórek: .........................
Zadanie 9. (0–5)
Na schemacie przedstawiono wartości ciśnień parcjalnych (prężności) gazów oddechowych w powietrzu atmosferycznym, w pęcherzykach płucnych oraz we krwi naczyń krwionośnych.

Legenda:
PO2  – ciśnienie parcjalne tlenu
PCO2 – ciśnienie parcjalne dwutlenku węgla (tlenku węgla(IV))


Na podstawie: E. McLaughlin, J. Stamford, D. White, Fizjologia człowieka. Krótkie wykłady, Warszawa 2008.
pwz: 73%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 9.1.
Korzystając z danych na schemacie, narysuj wykres słupkowy porównujący ciśnienie parcjalne tlenu i dwutlenku węgla w powietrzu pęcherzykowym oraz we krwi tętnicy płucnej i żyły płucnej.

pwz: 68%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 9.2.
Zaznacz na rysunku za pomocą strzałki kierunek przepływu krwi w naczyniu włosowatym.
pwz: 64%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 9.3.
Uzupełnij poniższe zdania tak, aby zawierały informacje prawdziwe.
Wymiana gazowa pomiędzy powietrzem pęcherzykowym a krwią w naczyniach włosowatych otaczających pęcherzyk płucny zachodzi na drodze .
Ponieważ ciśnienie parcjalne tlenu we krwi doprowadzanej do pęcherzyka płucnego jest niż w pęcherzyku płucnym,
a ciśnienie parcjalne dwutlenku węgla w tej krwi jest niż w pęcherzyku płucnym, tlen przenika z pęcherzyka do krwi, natomiast dwutlenek węgla przenika z krwi do pęcherzyka płucnego.
pwz: 31%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 9.4.
Wyjaśnij, dlaczego wartości ciśnienia parcjalnego tlenu we krwi tętnicy płucnej są niższe niż wartości ciśnienia parcjalnego we krwi żyły płucnej. W odpowiedzi uwzględnij wymianę tego gazu zachodzącą w płucach oraz w tkankach organizmu.
.........................
.........................
pwz: 37%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 10. (0–1)
W tabeli przedstawiono wybrane cząsteczki i komórki uczestniczące w zwalczaniu zakażeń.

Uzupełnij tabelę – wpisz w miejsca oznaczone literami A, B, C i D odpowiednie rodzaje odporności warunkowanej przez wymienione w tabeli cząsteczki i komórki. Wybierz je z poniższych:
nieswoista, swoista, komórkowa, humoralna.

Rodzaje odporności

A. ......................... 

B. .........................

C. .........................

interferony

lizozym

fagocyty

komórki NK

D. .........................

przeciwciała

limfocyty Tc

Zadanie 11. (0–2)
Autonomiczny układ nerwowy człowieka składa się z dwóch działających antagonistycznie części: współczulnej i przywspółczulnej. W tabeli przedstawiono przykłady efektów oddziaływania autonomicznego układu nerwowego na wybrane narządy trzech układów narządów w organizmie człowieka.


Efekt działania układu

przywspółczulnego

współczulnego

serce

zmniejszenie częstości skurczów serca

zwiększenie częstości skurczów serca

gruczoły jelitowe

wzrost wydzielania enzymów trawiennych

zmniejszenie wydzielania enzymów trawiennych

oskrzela (mięśnie oskrzelowe)

zwężenie oskrzeli

rozszerzenie oskrzeli


pwz: 50%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 11.1.
Podaj, do której części autonomicznego układu nerwowego – współczulnej czy przywspółczulnej – odnosi się określenie używane w sytuacji zagrożenia: „walcz lub uciekaj”. Odpowiedź uzasadnij, uwzględniając wybrany z tabeli przykład działania tego układu w powiązaniu z pracą mięśni szkieletowych.
.........................
.........................
pwz: 52%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 11.2.
Przedstaw, jakie znaczenie dla prawidłowego funkcjonowania organizmu ma antagonistyczne działanie obu części autonomicznego układu nerwowego w sytuacji wystąpienia zagrożenia i po jego ustąpieniu.
.........................
.........................
Zadanie 12. (0–2)
Autosomalny allel (D), warunkujący obecność w erytrocytach czynnika Rh (Rh+), dominuje nad allelem (d) – brak czynnika Rh (Rh). W tabeli przedstawiono pary rodziców (A–D) o różnych grupach krwi pod względem czynnika Rh.


kobieta

mężczyzna

A.

Rh-

Rh-

B.

Rh-

Rh+

C.

Rh+

Rh-

D.

Rh+

Rh+

pwz: 23%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 12.1.
Podaj wszystkie możliwe pary genotypów rodzicielskich, przy których prawdopodobieństwo urodzenia dziecka mającego grupę krwi Rh+ wynosi 100%. Zastosuj odpowiednie oznaczenia alleli, które zostały podane w tekście.
.........................
pwz: 35%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 12.2.
Spośród par rodziców A–D podaj tę, w przypadku której może wystąpić choroba hemolityczna noworodka, wywołana tzw. konfliktem serologicznym. Odpowiedź uzasadnij, uwzględniając obecność Rh w erytrocytach dziecka i matki oraz możliwe genotypy ojca.
.........................
.........................
pwz: 19%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 13. (0–1)
U niektórych osób dochodzi do zaburzeń w wydzielaniu kortyzolu, który jest wytwarzany z cholesterolu w korze nadnerczy. Przed rozpoczęciem leczenia pacjenta ważne jest ustalenie, czy niedobór kortyzolu spowodowany jest niedoczynnością przysadki w zakresie produkcji ACTH (kortykotropiny), czy też przyczyną jest uszkodzenie komórek kory nadnerczy. W tym celu przeprowadza się specjalny test z metyraponem – inhibitorem enzymu, odpowiedzialnego za ostatni etap produkcji kortyzolu z cholesterolu.
Oznacza się u pacjenta poziom ACTH i 11-deoksykortyzolu, następnie podaje się metyrapon, i po określonym czasie znów oznacza się poziom obu substancji.
Na schemacie przedstawiono regulację wydzielania kortyzolu oraz miejsce działania metyraponu.
Na podstawie: Diagnostyka czynnościowa człowieka, pod red. W.Z. Traczyka, Warszawa 1999.

Zaznacz poprawne dokończenie zdania.

Po podaniu metyraponu u pacjentów z niedoczynnością kortykotropową przysadki
Zadanie 14. (0–2)
W siatkówce oka komórki fotoreceptorowe (pręcikonośne i czopkonośne) zawierają barwnik wzrokowy, który składa się z absorbującej światło cząsteczki retinalu, pochodnej witaminy A, połączonej z białkiem − opsyną. Kiedy barwnik pochłania dostateczną ilość energii świetlnej, zostają zainicjowane przemiany fizykochemiczne retinalu, które prowadzą do powstania impulsów nerwowych w fotoreceptorach i ich przekazu z siatkówki do mózgu, co warunkuje widzenie. Komórki pręcikonośne reagują w niskich natężeniach oświetlenia, a czopkonośne – w średnich i wysokich.
Siatkówka przystosowuje się do odbierania promieni świetlnych o różnym natężeniu. W zaadaptowanej do bardzo silnego światła siatkówce przeważająca część fotoreceptorów ma rozłożony barwnik wzrokowy i jest niepobudliwa. Adaptacja siatkówki do całkowitej ciemności trwa ponad godzinę. Dochodzi wtedy do resyntezy barwnika w fotoreceptorach. Dzięki temu jest odpowiednia ilość barwnika i minimalne natężenie promieniowania świetlnego może być odbierane przez maksymalną liczbę fotoreceptorów.

Na podstawie: W.Z. Traczyk, A. Trzebski, Fizjologia człowieka z elementami fizjologii stosowanej i klinicznej,
Warszawa 2007.
pwz: 44%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 14.1.
Uwzględniając mechanizm widzenia opisany w tekście, wyjaśnij, dlaczego człowiek po przejściu ze słonecznego miejsca do zacienionego pomieszczenia zaczyna dostrzegać zarysy przedmiotów dopiero po pewnym czasie.
.........................
.........................
pwz: 48%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 14.2.
Wykaż zależność między niedoborem witaminy A w organizmie człowieka a pogorszeniem widzenia po zmierzchu. W odpowiedzi uwzględnij odpowiedni rodzaj fotoreceptorów.
.........................
.........................
Zadanie 15. (0–2)
Na rysunku przedstawiono roślinę wilca ziemniaczanego, znaną pod nazwą „batat”. Jest to bylina powszechnie uprawiana w strefie międzyzwrotnikowej, na obszarach o wilgotnym i ciepłym klimacie. Bulwy korzeniowe tej rośliny, cenione jako pokarm człowieka, zawierają dużą ilość skrobi oraz inne węglowodany, a także białka, wiele witamin i składników mineralnych.
Na podstawie: Encyklopedia szkolna. Biologia, pod red. A. Urbanka, Warszawa 1999.
pwz: 23%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 15.1.
Określ, do której grupy roślin – jednoliściennych czy dwuliściennych – najprawdopodobniej należy batat. Odpowiedź uzasadnij, podając widoczne na rysunku dwie cechy liścia typowe dla tej grupy.
.........................
.........................
pwz: 58%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 15.2.
Przedstaw funkcję korzenia batata, inną niż utrzymywanie rośliny w podłożu i pobieranie wody z solami mineralnymi. Uwzględnij widoczne na rysunku przystosowanie w budowie korzenia do pełnienia tej funkcji.
.........................
.........................
Zadanie 16. (0–3)
Przeprowadzono doświadczenie badające intensywność zachodzenia pewnego procesu w liściu wybranej rośliny. Poniżej przedstawiono opis przebiegu doświadczenia i uzyskane wyniki.

Obie strony blaszki liścia wybranej rośliny zakryto suchymi papierkami kobaltowymi. Suchy papierek kobaltowy ma kolor niebieski, natomiast wilgotny zmienia kolor na różowy. Ogonek liścia umieszczono w probówce z wodą, na której powierzchnię naniesiono warstwę oleju. Trzeci taki sam papierek, zawieszono na statywie w pewnej odległości od liścia. Cały zestaw badawczy umieszczono pod szklanym kloszem, zapewniając jednocześnie optymalne warunki oświetlenia i temperatury. W poniższej tabeli zamieszczono wyniki doświadczenia.

Miejsce umieszczenia papierka kobaltowego

Czas, po którym papierek kobaltowy zmienił kolor na różowy

1.

dolna powierzchnia liścia

bardzo krótki

2.

górna powierzchnia liścia

krótki

3.

papierek zawieszony na statywie

dłuższy niż w przypadkach 1. i 2.

pwz: 57%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 16.1.
Podaj nazwę procesu zachodzącego w roślinie, którego efektem była zmiana barwy papierków kobaltowych umieszczonych na liściu.
.........................
pwz: 19%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 16.2.
Podaj, w jakim celu pod kloszem umieszczono zawieszony na statywie papierek kobaltowy. Odpowiedź uzasadnij.
.........................
pwz: 52%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 16.3.
Poniżej numerami I–IV oznaczono opisy rozmieszczenia aparatów szparkowych w liściu, a literami A–C oznaczono przykłady środowisk życia roślin.

Rozmieszczenie aparatów szparkowych w liściu
I. aparaty szparkowe występują tylko na górnej powierzchni blaszki liściowej
II. dużo aparatów szparkowych występuje w skórce dolnej, brak lub nieliczne aparaty szparkowe w skórce górnej
III. aparaty szparkowe są obecne po obu stronach liścia, ale więcej występuje na górnej powierzchni blaszki liściowej
IV. brak aparatów szparkowych w skórce górnej i dolnej liścia

Środowisko życia roślin
A. wodne (liść rośliny wodnej całkowicie zanurzonej)
B. wodno-atmosferyczne (pływający liść rośliny wodnej, którego ogonek jest całkowicie zanurzony, a blaszka leży na powierzchni wody)
C. lądowe (liść rośliny lądowej otoczony powietrzem atmosferycznym)
Uzupełnij poniższe zdanie.
Na podstawie wyników doświadczenia można przypuszczać, że w liściu badanej rośliny
a więc jest to liść rośliny żyjącej w środowisku
pwz: 36%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 17. (0–1)
Rośliny dnia długiego to rośliny zakwitające podczas pory roku, w której dni są dłuższe od pewnej krytycznej wartości długości dnia. Rośliny dnia krótkiego to rośliny kwitnące podczas dni krótszych od pewnej krytycznej wartości. Przeprowadzono doświadczenie, którego celem było określenie, czy u roślin występuje substancja powodująca zakwitanie, która przy odpowiednim dla danej rośliny fotoperiodzie pobudza pąki do rozwoju w kwiaty. W tym celu niekwitnącą roślinę dnia długiego zaszczepiono na kwitnącej roślinie dnia krótkiego i poddano działaniu krótkiego dnia. Wynik doświadczenia przedstawiono na rysunku.
Na podstawie: Biologia, red. N.A. Campbell, Poznań 2012.

Przedstaw wynik doświadczenia przedstawiony na ilustracji oraz podaj jego możliwą przyczynę, korzystając z informacji podanych w tekście i własnej wiedzy
..........................
.........................
Zadanie 18. (0–5)
U groszku pachnącego (Lathyrus odoratus) autosomalne allele (A) i (B) dwóch różnych genów kodują dwa enzymy odpowiedzialne za wytworzenie różowego barwnika płatków kwiatów. Każdy z tych enzymów katalizuje jeden z dwóch etapów syntezy barwnika różowego i brak nawet jednego z nich powoduje białą barwę kwiatów. Skrzyżowano dwie biało kwitnące rośliny, w wyniku czego w pokoleniu pierwszym (F1) otrzymano wyłącznie rośliny mające kwiaty różowe o genotypie AaBb, gdzie recesywne allele tych genów (a) i (b) to zmutowane allele kodujące niefunkcjonalne enzymy. Każdy z dwóch genów odpowiedzialnych za wytworzenie różowego barwnika kwiatów występuje w populacji groszku w postaci dwóch alleli.
pwz: 44%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 18.1.
Podaj wszystkie możliwe genotypy roślin o kwiatach białych oraz podkreśl wśród nich dwa, których skrzyżowanie ze sobą doprowadzi do uzyskania wyłącznie roślin o kwiatach różowych.
.........................
pwz: 48%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 18.2.
Wykonaj krzyżówkę genetyczną (szachownicę Punnetta) i na jej podstawie określ fenotypy pokolenia drugiego (F2) powstałego po skrzyżowaniu roślin o genotypach AaBb. Podaj, w jakim stosunku liczbowym występują fenotypy w pokoleniu F2.

Fenotypy w pokoleniu F2: .........................
Stosunek liczbowy fenotypów F2: .........................
pwz: 31%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 18.3.
Oceń, czy poniższe informacje dotyczące dziedziczenia barwy kwiatów u groszku pachnącego są prawdziwe.
Każdy z dwóch enzymów niezbędnych do wytworzenia różowego barwnika kwiatów u groszku pachnącego kodowany jest przez allele wielokrotne.
Podwójne heterozygoty groszku mają fenotyp mieszany, czyli prezentują barwy kwiatów każdego z obojga homozygotycznych rodziców.
Cecha – biała barwa – kwiatów groszku ujawnia się u osobnika będącego pojedynczą lub podwójną homozygotą recesywną.
Zadanie 19. (0–4)
Cząsteczka insuliny składa się z dwóch różnych łańcuchów polipeptydowych – A i B. Występują w niej trzy mostki dwusiarczkowe stabilizujące strukturę cząsteczki: jeden w łańcuchu polipeptydowym A oraz dwa – łączące łańcuchy A i B. Początek sekwencji kodującej (znajdującej się na nici nieulegającej transkrypcji) genu kodującego jeden z łańcuchów polipeptydowych insuliny jest następujący:
5’ ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCG … 3’.
Podczas eksperymentu użyto czynnika mutagennego, który w dwu przypadkach wywołał delecje, tzn. transkrybowane mRNA było pozbawione fragmentu sekwencji składającego się z kolejnych nukleotydów. W wyniku translacji powstały łańcuchy polipeptydowe (1. i 2.) o innej sekwencji aminokwasów niż w łańcuchu prawidłowym.
I. przypadek – polipeptyd 1. powstał na podstawie delecji 4 nukleotydów (od 10 do 13 nukleotydu sekwencji kodującej włącznie)
II. przypadek – polipeptyd 2. powstał na podstawie delecji 9 nukleotydów (od 10 do 18 nukleotydu sekwencji kodującej włącznie).
pwz: 42%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 19.1.
Na podstawie tekstu uzasadnij, że cząsteczka insuliny ma strukturę III- i IV-rzędową.

Struktura III-rzędowa:
.........................
.........................

Struktura IV-rzędowa:
.........................
.........................
pwz: 19%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 19.2.
Określ, który polipeptyd (1. czy 2.) będzie miał bardziej zmienioną sekwencję aminokwasów w porównaniu z polipeptydem prawidłowym. Odpowiedź uzasadnij.
.........................
.........................
pwz: 7%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 19.3.
Podaj nazwę czwartego aminokwasu w sekwencji prawidłowego polipeptydu oraz nazwę czwartego aminokwasu w polipeptydzie 1. Przyjmij założenie, że w ich skład nie wchodzi aminokwas kodowany przez kodon START.

Polipeptyd prawidłowy: .........................
Polipeptyd 1: .........................
pwz: 23%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 19.4.
Określ, czy opisane mutacje mogły być spowodowane działaniem kolchicyny, która jest czynnikiem mutagennym blokującym wrzeciono kariokinetyczne. Odpowiedź uzasadnij.
.........................
.........................
Zadanie 20. (0–3)
Ekologiczna nisza podstawowa gatunku, czyli nisza potencjalnie zajmowana przez ten gatunek w warunkach optymalnych, jest często inna niż nisza zrealizowana, czyli rzeczywista, zajmowana w danych warunkach abiotycznych i biotycznych. Aby sprawdzić, czy na niszę ekologiczną wpływa konkurencja międzygatunkowa, badano dwa gatunki pąkli (skorupiaki osiadłe, obojnaki, rozmnażające się m.in. przez zapłodnienie krzyżowe). Pąkle te wykazują warstwowe rozmieszczenie na zalewanych wodą skałach wzdłuż wybrzeży Szkocji, Chthamalus stellatus jest znajdowany wyżej na skałach niż Balanus balanoides (rysunek A). Po usunięciu przez badaczy B. balanoides z niektórych jego stanowisk okazało się, że C. stellatus rozprzestrzenił się na tereny wcześniej zajmowane przez B. balanoides (rysunek B).

A

B
Na podstawie: Biologia, red. N.A. Campbell, Poznań 2012.a
pwz: 21%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 20.1.
Sformułuj wniosek dotyczący wpływu konkurencji międzygatunkowej na niszę ekologiczną Chthamalus stellatus. We wniosku uwzględnij niszę zrealizowaną i podstawową.
.........................
.........................
pwz: 30%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 20.2.
Oceń, czy na podstawie opisu tego doświadczenia i jego wyników można sformułować podane wnioski. Zaznacz tak, jeśli wniosek wynika z tego doświadczenia, albo nie – jeśli z niego nie wynika.
Zróżnicowanie nisz zrealizowanych Chthamalus stellatus i Balanus balanoides pozwala na koegzystencję populacji obu gatunków w biocenozie.
Usunięcie Chthamalus stellatus z jego stanowiska spowoduje, że Balanus balanoides zajmie wyższe partie skał.
Chthamalus stellatus ma szeroki zakres tolerancji, a Balanus balanoides ma wąski zakres tolerancji.
pwz: 55%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 20.3.
Korzystając z podanych informacji, przedstaw jedną korzyść, jaką odnoszą pąkle z życia w skupiskach.
.........................
.........................
Zadanie 21. (0–3)
Informacja 1.
Rośliny mięsożerne występują zwykle w siedliskach ubogich w składniki pokarmowe. Ich systemy korzeniowe są słabo wykształcone. W toku ewolucji mięsożerność pojawiała się wśród roślin kilkakrotnie, niezależnie od siebie. Są trzy odrębne rodziny roślin dzbankowatych, których przedstawiciele wykształcają „dzbanki”: Sarraceniaceae, rosnące w północnej i południowej Ameryce, Nepenthaceae w Azji oraz Cephalotaceae w Australii. Rodziny te nie są ze sobą blisko spokrewnione, ale wszystkie wykształcają, z fragmentu lub całego liścia, podobnie wyglądające pułapki w kształcie dzbanka. W dzbankach zbiera się woda deszczowa, w której, w najprostszym przypadku, złapane zwierzęta topią się i ulegają strawieniu z udziałem występujących w nich bakterii. Bardziej wymyślne dzbanki same wydzielają do wnętrza enzymy trawienne.

Na podstawie: A.J. Lack, D.E. Evans, Krótkie wykłady. Biologia roślin, Warszawa 2005.

Informacja 2.
Jeden z gatunków z rodziny Nepenthaceae – dzbanecznik dwuostrogowy (N. bicalcarata) jest kolonizowany przez mrówki z gatunku Camponotus schmitzi, które żywią się jego nektarem oraz owadami wpadającymi do dzbanków. Wyciągnięcie ofiary z dzbanka może trwać nawet do 12 godzin i w tym czasie mrówki zostawiają w dzbanku bogate w azot odchody. Zauważono, że wyławiane są głównie największe ofiary, a ich niezjedzone szczątki trafiają z powrotem do dzbanka. Rośliny pozbawione mrówek są skarlałe. Mrówki te gnieżdżą się wyłącznie na N. bicalcarata i tylko wyjątkowo są znajdowane na innych roślinach.

Na podstawie: encyklopedia.naukowy.pl
pwz: 83%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 21.1.
Uzupełnij zagadnienia tak, aby były prawdziwe.
Zestawienie organizmów
1. dzbaneczniki - schwytane owady

Zależności międzygatunkowe
Zestawienie organizmów
2. mrówki C.schmitzi - dzbanecznik dwuostrogowy

Zależności międzygatunkowe
pwz: 21%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 21.2.
Na podstawie przedstawionych informacji określ, czy dzbankowate pułapki u opisanych roślin mięsożernych są przykładem konwergencji, czy – dywergencji. Odpowiedź uzasadnij.
.........................
.........................
pwz: 14%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 21.3.
Wyjaśnij, dlaczego dzbaneczniki dwuostrogowe żyjące bez mrówek mają mniejsze rozmiary ciała. W odpowiedzi uwzględnij informacje dotyczące warunków życia dzbaneczników.
.........................
.........................
Zadanie 22. (0–2)
Gatunek uznaje się za zagrożony, kiedy jego populacje mają bardzo małą liczebność. W rezerwacie Gombe w Tanzanii żyje około 100 szympansów. Liczba tych zwierząt, występujących w lasach równikowych na obszarze kilku państw afrykańskich, drastycznie się zmniejsza. Przyczynami są m.in. kurczenie się terenów leśnych i nielegalne polowania. Naczelne wykazują też podatność na choroby zakaźne typowe dla ludzi. Gdy więc firmy zajmujące się wyrębem lasu coraz głębiej penetrują dżunglę, rośnie prawdopodobieństwo rozprzestrzeniania się infekcji niebezpiecznych dla życia szympansów. W celu ochrony szympansów podjęto następujące działania: otoczono rezerwat kordonem zieleni, utworzono migracyjne korytarze leśne prowadzące z rezerwatu do innych lasów tropikalnych zamieszkałych przez niewielkie populacje szympansów, ograniczono napływ turystów, zabroniono turystom zbliżania się do tych zwierząt. Do rezerwatu nie są wpuszczane nawet lekko zainfekowane i kaszlące osoby.
Na podstawie: K. Wong, Jane z afrykańskiej dżungli, „Świat Nauki”, nr 1, 2011.
pwz: 34%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 22.1.
Wyjaśnij, dlaczego istnienie populacji szympansów o małej liczebności jest zagrożone. W odpowiedzi uwzględnij podłoże genetyczne tego zjawiska.
.........................
.........................
pwz: 65%
infoPoziom wykonania zadania - im wyższy, tym zadanie było łatwiejsze dla zdających.
Zadanie 22.2.
Podaj, które z wymienionych działań dotyczących ochrony szympansów ma na celu zwiększenie różnorodności genetycznej populacji z rezerwatu Gombe. Odpowiedź uzasadnij.
.........................
.........................





Rekrutacja na studia wg przedmiotów zdawanych na maturze


Wyszukaj kierunki studiów i uczelnie, w których brany jest pod uwagę tylko 1 przedmiot zdawany na maturze na poziomie podstawowym (często uczelnie dają do wyboru kilka przedmiotów a wybieramy z nich jeden):

Przykłady:

kierunki studiów po maturze z WOS


Poniżej podajemy wybrane linki do kierunki studiów na uczelniach, w których są brane pod uwagę wyniki tylko z dwóch przedmiotów zdawanych na maturze na poziomie podstawowym
(często uczelnie dają wyboru więcej przedmiotów a wybieramy z nich dwa):

Przykłady:

kierunki po maturze z polskiego i matematyki
kierunki po maturze z polskiego i angielskiego
kierunki po maturze z polskiego i historii
kierunki po maturze z polskiego i wiedzy o społeczeństwie

kierunki po maturze z matematyki i angielskiego
kierunki po maturze z matematyki i fizyki
kierunki po maturze z matematyki i chemii
kierunki po maturze z matematyki i informatyki

kierunki po maturze z biologii i chemii
kierunki po maturze z biologii i
angielskiego
kierunki po maturze z chemii i angielskiego
kierunki po maturze z biologii i geografii
kierunki po maturze z chemii i geografii
Polityka Prywatności